ID: 903953301_903953302

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 903953301 903953302
Species Human (GRCh38) Human (GRCh38)
Location 1:27008973-27008995 1:27009013-27009035
Sequence CCTTCTTTTTTTTTTTTTTTTTT GAGTCCTGATTTTGTAGCTGAGG
Strand - +
Off-target summary {0: 2880, 1: 30954, 2: 37506, 3: 74036, 4: 136962} {0: 1, 1: 0, 2: 0, 3: 17, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!