ID: 903968847_903968854

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 903968847 903968854
Species Human (GRCh38) Human (GRCh38)
Location 1:27106217-27106239 1:27106248-27106270
Sequence CCTGGGTCCCTCAGCCCAGAGTG TCCTCAATCCAAGAGCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 321} {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!