ID: 903982708_903982710

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 903982708 903982710
Species Human (GRCh38) Human (GRCh38)
Location 1:27201407-27201429 1:27201428-27201450
Sequence CCACGGTAATGTTCTCATTCTCG CGTCCGCCTCGAAGGTGACCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 64} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!