ID: 903990119_903990123

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 903990119 903990123
Species Human (GRCh38) Human (GRCh38)
Location 1:27261534-27261556 1:27261574-27261596
Sequence CCTGTCCTCTGCAGTTTGTATGT CTGTGAGATAAATGGATGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 218} {0: 1, 1: 0, 2: 1, 3: 22, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!