ID: 904003452_904003467

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 904003452 904003467
Species Human (GRCh38) Human (GRCh38)
Location 1:27351114-27351136 1:27351164-27351186
Sequence CCCCGAGGGCGCTAGGACCCCTA TCTTCTAGCCGCACCCCATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27} {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!