ID: 904012542_904012554

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 904012542 904012554
Species Human (GRCh38) Human (GRCh38)
Location 1:27398145-27398167 1:27398189-27398211
Sequence CCCAAAATGTAATATTACACAGT CAGGGGAAGAAGGATGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 56, 4: 444} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!