ID: 904037111_904037118

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 904037111 904037118
Species Human (GRCh38) Human (GRCh38)
Location 1:27564878-27564900 1:27564911-27564933
Sequence CCTGAGATGTCAGTGTCTAGGGC ACAGGAGCCCAGAGAGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 96} {0: 1, 1: 2, 2: 19, 3: 188, 4: 1274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!