ID: 904058389_904058398

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 904058389 904058398
Species Human (GRCh38) Human (GRCh38)
Location 1:27687088-27687110 1:27687133-27687155
Sequence CCGTGGTGTTCAGGCCTTGTCTG GTTCTTGGTTACCACCTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 215} {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!