ID: 904090368_904090376

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 904090368 904090376
Species Human (GRCh38) Human (GRCh38)
Location 1:27940867-27940889 1:27940885-27940907
Sequence CCAGTCTCACTCCTGGCCCAAGG CAAGGGGTAATTGCAGGTAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 275} {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!