ID: 904128753_904128767

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 904128753 904128767
Species Human (GRCh38) Human (GRCh38)
Location 1:28260309-28260331 1:28260348-28260370
Sequence CCGGAGCGGCCAGACCACTCCTC GCGGAGTCCCTTCCTCTTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 103} {0: 1, 1: 1, 2: 0, 3: 8, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!