ID: 904181390_904181401

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 904181390 904181401
Species Human (GRCh38) Human (GRCh38)
Location 1:28668972-28668994 1:28668997-28669019
Sequence CCTCCCCACGCCCTGTGCGTGCC CGCCGCCGCCGGGGAGCGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 243} {0: 1, 1: 0, 2: 4, 3: 36, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!