|
Left Crispr |
Right Crispr |
| Crispr ID |
904192912 |
904192923 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:28761476-28761498
|
1:28761508-28761530
|
| Sequence |
CCTGTAATCCCAGCACATAACGG |
CAGGTGGATCACCTGAGGTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 33, 3: 968, 4: 21155} |
{0: 1026, 1: 18826, 2: 47760, 3: 81950, 4: 99275} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|