|
Left Crispr |
Right Crispr |
| Crispr ID |
904228075 |
904228080 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:29041305-29041327
|
1:29041322-29041344
|
| Sequence |
CCCTGCCTCTACTAAAGGTACAA |
GTACAAAAATTAGCTGGGCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 93, 2: 4540, 3: 76197, 4: 171325} |
{0: 43, 1: 2647, 2: 45681, 3: 82245, 4: 118828} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|