ID: 904252734_904252745

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 904252734 904252745
Species Human (GRCh38) Human (GRCh38)
Location 1:29236591-29236613 1:29236609-29236631
Sequence CCGGGGGCGGCGTCCCCCGCGCC GCGCCGGGCCCCGGGACGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 295} {0: 1, 1: 1, 2: 2, 3: 48, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!