ID: 904262803_904262809

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 904262803 904262809
Species Human (GRCh38) Human (GRCh38)
Location 1:29299705-29299727 1:29299745-29299767
Sequence CCTTTCTCTGCCAGGAGAGCTCT CACTTTCCACAAAGAGCACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 280} {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!