ID: 904265690_904265697

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 904265690 904265697
Species Human (GRCh38) Human (GRCh38)
Location 1:29317464-29317486 1:29317513-29317535
Sequence CCCTATTTCACAGTCGAGGAAAC CTGAGGTTATGTGGGTGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 57, 3: 617, 4: 3086} {0: 1, 1: 0, 2: 1, 3: 10, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!