ID: 904290325_904290334

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 904290325 904290334
Species Human (GRCh38) Human (GRCh38)
Location 1:29481195-29481217 1:29481229-29481251
Sequence CCTCTAGTGTAGCAAGCTGTAGC CATGTGGGTGGGCACGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 50} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!