ID: 904312688_904312691

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 904312688 904312691
Species Human (GRCh38) Human (GRCh38)
Location 1:29639564-29639586 1:29639589-29639611
Sequence CCTAGGGAAACAGACCTGGCCTC ACCTCAGAGAATATACATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 216} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!