ID: 904314519_904314530

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 904314519 904314530
Species Human (GRCh38) Human (GRCh38)
Location 1:29651642-29651664 1:29651667-29651689
Sequence CCCTCCCTCACCTTGGCTGCCCG CTGGCCATGCTGGCTCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!