ID: 904328423_904328446

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 904328423 904328446
Species Human (GRCh38) Human (GRCh38)
Location 1:29742572-29742594 1:29742625-29742647
Sequence CCTCCTCCTCCCCCACCCCATGG GGGATTGGGAACATGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 26, 3: 295, 4: 2214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!