ID: 904328430_904328445

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 904328430 904328445
Species Human (GRCh38) Human (GRCh38)
Location 1:29742583-29742605 1:29742619-29742641
Sequence CCCACCCCATGGCCATGGTTCCA TGTGTGGGGATTGGGAACATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!