ID: 904328435_904328448

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 904328435 904328448
Species Human (GRCh38) Human (GRCh38)
Location 1:29742589-29742611 1:29742630-29742652
Sequence CCATGGCCATGGTTCCAGGCATG TGGGAACATGGGCTGTGGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 58, 4: 648}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!