ID: 904329284_904329286

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 904329284 904329286
Species Human (GRCh38) Human (GRCh38)
Location 1:29747422-29747444 1:29747438-29747460
Sequence CCAGGGCCATCTTTGGATCCTTG ATCCTTGCCTCTCCCTGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 53, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!