ID: 904329285_904329299

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 904329285 904329299
Species Human (GRCh38) Human (GRCh38)
Location 1:29747428-29747450 1:29747471-29747493
Sequence CCATCTTTGGATCCTTGCCTCTC TCCACAGCAGTGTGGGCATCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 13, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!