ID: 904329297_904329303

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 904329297 904329303
Species Human (GRCh38) Human (GRCh38)
Location 1:29747466-29747488 1:29747486-29747508
Sequence CCATCTCCACAGCAGTGTGGGCA GCATCGGGCAGAGGCTTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!