ID: 904342086_904342090

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 904342086 904342090
Species Human (GRCh38) Human (GRCh38)
Location 1:29842832-29842854 1:29842873-29842895
Sequence CCTGAACAACATAGAGAGACCCT ACATACAAACAAAATTTGGAAGG
Strand - +
Off-target summary {0: 3, 1: 94, 2: 1702, 3: 17652, 4: 71921} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!