ID: 904371190_904371198

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 904371190 904371198
Species Human (GRCh38) Human (GRCh38)
Location 1:30048487-30048509 1:30048507-30048529
Sequence CCCTGCCCAGGGCTGCCCATCTG CTGCACAGCAGTGTGGGCATCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!