ID: 904382687_904382689

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 904382687 904382689
Species Human (GRCh38) Human (GRCh38)
Location 1:30122031-30122053 1:30122050-30122072
Sequence CCAGGCTGGTGATGACATGTGGG TGGGAGCCCCATCATGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!