ID: 904411771_904411779

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 904411771 904411779
Species Human (GRCh38) Human (GRCh38)
Location 1:30329029-30329051 1:30329060-30329082
Sequence CCTTCTGCCCTCAGGACTGGTGG CCAAGTTGAATGTTGCCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!