ID: 904425387_904425398

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 904425387 904425398
Species Human (GRCh38) Human (GRCh38)
Location 1:30419451-30419473 1:30419489-30419511
Sequence CCAACCCATTCATGTGGCCTCCA CGCCACAGAGCAGGTGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 635} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!