ID: 904425389_904425398

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 904425389 904425398
Species Human (GRCh38) Human (GRCh38)
Location 1:30419456-30419478 1:30419489-30419511
Sequence CCATTCATGTGGCCTCCAAACCT CGCCACAGAGCAGGTGTGAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!