ID: 904425394_904425402

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 904425394 904425402
Species Human (GRCh38) Human (GRCh38)
Location 1:30419476-30419498 1:30419511-30419533
Sequence CCTGGGACAGTCCCGCCACAGAG GAGCTGTTGACCAATCCATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!