ID: 904430743_904430757

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 904430743 904430757
Species Human (GRCh38) Human (GRCh38)
Location 1:30462545-30462567 1:30462584-30462606
Sequence CCCTTCACAGCGGGCACGTTGTT GGGCTGCGGGAGGGGGAAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 27, 3: 290, 4: 2469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!