ID: 904459370_904459381

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 904459370 904459381
Species Human (GRCh38) Human (GRCh38)
Location 1:30666494-30666516 1:30666524-30666546
Sequence CCAGGGATGGGGAAGCTAAGCAG CCCAGCTCGGAGAAGGTGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 23, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!