ID: 904473590_904473597

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 904473590 904473597
Species Human (GRCh38) Human (GRCh38)
Location 1:30750748-30750770 1:30750771-30750793
Sequence CCCTCCTGAGCCTGTTTCCTCAT CTGTAAAATGGAGGCCCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 100, 3: 336, 4: 1092} {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!