ID: 904483862_904483864

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 904483862 904483864
Species Human (GRCh38) Human (GRCh38)
Location 1:30811223-30811245 1:30811252-30811274
Sequence CCAAGCTTTATTTGCATAGACAG CAGTTGAGCTTAGAAGAAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 27, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!