ID: 904494584_904494592

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 904494584 904494592
Species Human (GRCh38) Human (GRCh38)
Location 1:30879480-30879502 1:30879500-30879522
Sequence CCAGCTCCCCTCTGCCCAGAAAG AAGAAAAATACCCACGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 72, 4: 589} {0: 1, 1: 0, 2: 1, 3: 14, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!