ID: 904495995_904495998

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 904495995 904495998
Species Human (GRCh38) Human (GRCh38)
Location 1:30887074-30887096 1:30887094-30887116
Sequence CCTCACACTCAGCTCCCTGCACA ACAGAGACAGCCTGAAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 67, 4: 545} {0: 1, 1: 1, 2: 4, 3: 39, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!