ID: 904496142_904496147

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 904496142 904496147
Species Human (GRCh38) Human (GRCh38)
Location 1:30887844-30887866 1:30887876-30887898
Sequence CCAAGGCAGGCCCTGCTCTTCTC TCTCCCTGTGTGTAAAACCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 490} {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!