ID: 904496690_904496703

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 904496690 904496703
Species Human (GRCh38) Human (GRCh38)
Location 1:30891228-30891250 1:30891266-30891288
Sequence CCATCTGCCCTCTGTCCCCATGG CTGAGGACAGGTGCCTCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 89, 4: 676} {0: 1, 1: 0, 2: 3, 3: 17, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!