|
Left Crispr |
Right Crispr |
| Crispr ID |
904511107 |
904511112 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:31008883-31008905
|
1:31008911-31008933
|
| Sequence |
CCCCTGCAAGGCCGGGCGCGGTG |
CACCTATAATCCTAGCACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 6, 2: 39, 3: 207, 4: 895} |
{0: 634, 1: 14037, 2: 104796, 3: 239076, 4: 254496} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|