ID: 904511107_904511115

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 904511107 904511115
Species Human (GRCh38) Human (GRCh38)
Location 1:31008883-31008905 1:31008915-31008937
Sequence CCCCTGCAAGGCCGGGCGCGGTG TATAATCCTAGCACTTTGGGAGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 39, 3: 207, 4: 895} {0: 2529, 1: 52066, 2: 341755, 3: 245650, 4: 128975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!