ID: 904511542_904511547

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 904511542 904511547
Species Human (GRCh38) Human (GRCh38)
Location 1:31014107-31014129 1:31014155-31014177
Sequence CCTGGAAAACATGTGACAGCCCA AGTGTGGTAGCACATGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 344} {0: 2, 1: 65, 2: 525, 3: 1617, 4: 4089}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!