ID: 904528614_904528619

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 904528614 904528619
Species Human (GRCh38) Human (GRCh38)
Location 1:31154008-31154030 1:31154040-31154062
Sequence CCTCCGTCTCCTGGATTCAAGTG TCTCAGCCTCCTGAGTAGCTGGG
Strand - +
Off-target summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} {0: 7228, 1: 111845, 2: 214076, 3: 239146, 4: 143572}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!