ID: 904537303_904537308

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 904537303 904537308
Species Human (GRCh38) Human (GRCh38)
Location 1:31208347-31208369 1:31208387-31208409
Sequence CCCGCTTATGGAAACTTGTGTTC TGCTGCAGCTTTCTCATTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 144} {0: 1, 1: 0, 2: 2, 3: 23, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!