ID: 904546475_904546477

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 904546475 904546477
Species Human (GRCh38) Human (GRCh38)
Location 1:31277635-31277657 1:31277657-31277679
Sequence CCGAAAATGAAGCATTGGCAGAA AAAATTTGAATGTTTGTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 415} {0: 1, 1: 0, 2: 1, 3: 38, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!