ID: 904566017_904566031

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 904566017 904566031
Species Human (GRCh38) Human (GRCh38)
Location 1:31428899-31428921 1:31428941-31428963
Sequence CCTTGGCTGGTGTGAGTGGGCTG GGTCTGGCAGGGGTCTTACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 91, 4: 472} {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!