ID: 904577140_904577144

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 904577140 904577144
Species Human (GRCh38) Human (GRCh38)
Location 1:31512193-31512215 1:31512216-31512238
Sequence CCAACAGGAGGATCACGTGAGCC CAGCAGTTTAAGGCCAGCCTAGG
Strand - +
Off-target summary No data {0: 2, 1: 133, 2: 4201, 3: 48410, 4: 70965}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!