ID: 904590603_904590617

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 904590603 904590617
Species Human (GRCh38) Human (GRCh38)
Location 1:31613386-31613408 1:31613437-31613459
Sequence CCACATCTGCAAAGCCCCTTTTG GTTAGGACGTGGACATCTTTGGG
Strand - +
Off-target summary {0: 2, 1: 14, 2: 47, 3: 97, 4: 333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!