ID: 904590607_904590617

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 904590607 904590617
Species Human (GRCh38) Human (GRCh38)
Location 1:31613402-31613424 1:31613437-31613459
Sequence CCTTTTGCCATGGAACATAGCCA GTTAGGACGTGGACATCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!